Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) czesc 4

Chociaż zanotowano niewielki, nieistotny hemodynamicznie ubytek przegrody międzyprzedsionkowej mięśniowo-podniebiennej w przypadku cewnikowania serca, nie zaobserwowano żadnych nieprawidłowości szkieletowych ani w badaniu fizykalnym, ani w badaniu radiologicznym. Oceny kliniczne podmiotu IV-25, który początkowo został zgłoszony jako dotknięty, 11 nie wykazały ani nieprawidłowości szkieletowych ani sercowych. Uważano go za niezmienionego w tych analizach. Rodzina B to pokolenie północnoamerykańskie, niezwiązane z rodziną A, z 31 członkami w trzech pokoleniach zagrożonych dziedziczeniem zespołu Holta-Orama (ryc. 1B). Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) czesc 4

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) cd

Z 49 członków rodziny w pięciu pokoleniach zagrożonych dziedziczeniem tego zaburzenia, 26 członków rodziny (11 mężczyzn i 15 kobiet) zostało dotkniętych – wzór zgodny z dziedziczeniem autosomalnym dominującym. Ocena kliniczna lub badanie historycznych zapisów wykazały, że każdy dotknięty członek rodziny był potomkiem chorego rodzica, potwierdzając tym samym wysoką penetrację genu choroby. W ocenach klinicznych członków rodziny (ryc. 1A) zidentyfikowano 18 osób, które przeżyły, dotkniętych zespołem Holta-Orama. Rycina 2. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) cd

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Zespół Holt-Orama (Dziedziczenie Mendla w Człowieku numer 142900), zwany także zespołem serca i ręki, jest dziedzicznym zaburzeniem, które powoduje anomalie kończyn górnych i serca. Zespół ten jest przenoszony jako autosomalna dominująca cecha, która jest wysoce penetrantem, chociaż objawy kliniczne są różne i wahają się od subklinicznych objawów radiologicznych do jawnej, zagrażającej życiu choroby. Anomalie górnych kończyn są zawsze obecne. Mogą one być jednostronne lub obustronne i obejmować struktury pochodzące z embrionalnego promienia promieniowego, zazwyczaj kości promieniowej, nadgarstka i późnej. Aplasia, niedorozwój, fuzja i anomalny rozwój tych struktur dają szerokie spektrum fenotypów, w tym potrójne lub nieobecne kciuki, skrócone ramiona i phocomelia. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)