Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) czesc 4

Chociaż zanotowano niewielki, nieistotny hemodynamicznie ubytek przegrody międzyprzedsionkowej mięśniowo-podniebiennej w przypadku cewnikowania serca, nie zaobserwowano żadnych nieprawidłowości szkieletowych ani w badaniu fizykalnym, ani w badaniu radiologicznym. Oceny kliniczne podmiotu IV-25, który początkowo został zgłoszony jako dotknięty, 11 nie wykazały ani nieprawidłowości szkieletowych ani sercowych. Uważano go za niezmienionego w tych analizach. Rodzina B to pokolenie północnoamerykańskie, niezwiązane z rodziną A, z 31 członkami w trzech pokoleniach zagrożonych dziedziczeniem zespołu Holta-Orama (ryc. 1B). Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) czesc 4

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) cd

Z 49 członków rodziny w pięciu pokoleniach zagrożonych dziedziczeniem tego zaburzenia, 26 członków rodziny (11 mężczyzn i 15 kobiet) zostało dotkniętych – wzór zgodny z dziedziczeniem autosomalnym dominującym. Ocena kliniczna lub badanie historycznych zapisów wykazały, że każdy dotknięty członek rodziny był potomkiem chorego rodzica, potwierdzając tym samym wysoką penetrację genu choroby. W ocenach klinicznych członków rodziny (ryc. 1A) zidentyfikowano 18 osób, które przeżyły, dotkniętych zespołem Holta-Orama. Rycina 2. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) cd

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Zespół Holt-Orama (Dziedziczenie Mendla w Człowieku numer 142900), zwany także zespołem serca i ręki, jest dziedzicznym zaburzeniem, które powoduje anomalie kończyn górnych i serca. Zespół ten jest przenoszony jako autosomalna dominująca cecha, która jest wysoce penetrantem, chociaż objawy kliniczne są różne i wahają się od subklinicznych objawów radiologicznych do jawnej, zagrażającej życiu choroby. Anomalie górnych kończyn są zawsze obecne. Mogą one być jednostronne lub obustronne i obejmować struktury pochodzące z embrionalnego promienia promieniowego, zazwyczaj kości promieniowej, nadgarstka i późnej. Aplasia, niedorozwój, fuzja i anomalny rozwój tych struktur dają szerokie spektrum fenotypów, w tym potrójne lub nieobecne kciuki, skrócone ramiona i phocomelia. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 7

W naszym badaniu jeden przypadek nadkomorowego obturacyjnego wodogłowia mógł być spowodowany zakażeniem ospą wietrzną-półpaścem; nie można jednak wyciągnąć ostatecznych wniosków, ponieważ dalsze dane serologiczne nie były dostępne. Zakażenie noworodkiem należy rozważyć, jeśli matka kurczy ospę wietrzną w ciągu ostatnich trzech tygodni ciąży. Nasilenie infekcji u noworodka związane jest z czasem wystąpienia infekcji u matki w czasie ciąży. Choroba może być łagodna, z kilkoma zmianami skórnymi (jak u pacjentów w naszym badaniu, którzy nabawili się ospy wietrznej 6 i 10 dni przed porodem) lub może być ciężka, z gorączką, wysypką krwotoczną i uogólnionym zaangażowaniem trzewnym. Ciężka choroba wiąże się ze śmiertelnością około 30 procent, ze śmiercią z powodu ciężkiej choroby płuc; jednak ponieważ dane te są stosunkowo stare, mogą nie odzwierciedlać postępów w krytycznej opiece nad chorymi noworodkami. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 7

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 6

Podczas badania kontrolnego po roku niemowlę to nie miało ani ospy wietrznej, ani półpaśca. Dyskusja
Badania epidemiologiczne teratogenności u ludzi zwykle obejmowały kobiety w ciąży narażone na leki, chemikalia lub czynniki zakaźne w pierwszym trymestrze lub, dokładniej, w okresie organogenezy. Jednakże, niekorzystne wyniki opisane w opisach przypadków4 sugerują, że okres ryzyka dla płodu spowodowany zakażeniem matczynym wirusem ospy wietrznej-półpaśca wykracza poza to okno, tak że niemowlęta urodzone z powodu embriopatii ospy wietrznej ulegają zakażeniu podczas pierwszych 20 tygodni ciąży. Obserwowaliśmy 106 kobiet zakażonych w tym okresie i oszacowaliśmy częstość występowania embriopatii ospy wietrznej na 1,2% (przedział ufności 95%, od 0 do 2,4%). To niskie ryzyko embriopatii sugeruje, że z nieznanych przyczyn zdolność wirusa do przechodzenia przez łożysko i zakażenia płodu jest ograniczona. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 6

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Tylko u dwóch pacjentów stwierdzono obecność alfa-fetoproteiny w surowicy po rozpoznaniu ospy wietrznej: matki niemowlęcia z zespołem ospy wietrznej opisanej powyżej oraz matki biorącej udział w badaniu klinicznym, w którym pomiar stężenia alfa-fetoproteiny był rutynową procedurą. W żadnym przypadku nie przeprowadzono reakcji łańcuchowej ani reakcji łańcuchowej polimerazy, aby zmierzyć przeciwciało płodu lub zidentyfikować wirusa w tkance płodu. Charakterystyka okołoporodowa
Obserwowano tendencję do przedwczesnych porodów (. 37 tygodni) u pacjentów, którzy zachorowali na ospę wietrzną w ciągu pierwszych 20 tygodni niż w grupie kontrolnej (14,3% [przedział ufności 95%, 10,5 do 18,1%] w porównaniu z 5,6% [zaufanie 95%] interwał, 3,2 do 8 procent], P = 0,05). Nie stwierdzono istotnej różnicy między niemowlętami z zakażeniem ospą wietrzną a grupą kontrolną w masie urodzeniowej (3336 . Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży czesc 4

W grupie z ospą wietrzną wystąpił nieistotny trend, w którym częściej zgłaszano planowe zakończenie leczenia (14,2% [przedział ufności 95%, 11 do 18%], w porównaniu z 7,5% [przedział ufności 95%, 4,9 do 10%] w grupie kontrolnej; P = 0,1) (tabela 3). Wszystkie spontaniczne poronienia w grupie ospy wietrznej wystąpiły w ciągu pierwszych 15 tygodni ciąży (dwa przypadki po 8 tygodniach, jeden o 9 tygodniach, jeden o 10 tygodniach i dwa o 12 tygodniach). Wszystkie zabiegi elektywne przeprowadzono przed 17 tygodniem ciąży, z różnych powodów (trzy zabiegi przeprowadzono z powodu postrzeganego ryzyka nieprawidłowości z powodu ospy wietrznej, jedna z powodu prenatalnej diagnozy choroby sierpowatokomórkowej, jedna z powodu ciąży wynikającej z gwałtu, i trzy z powodów osobistych lub społecznych, informacje na temat siedmiu procedur nie były dostępne). Spośród 86 żywych noworodków urodzonych w grupie ospy wietrznej, noworodek miał cechy odpowiadające embriopatii ospy wietrznej, z częstością 1,2% (przedział ufności 95%, od 0 do 2,4%). To niemowlę ważyło 1125 gi zostało dostarczone przez cesarskie cięcie w 35 tygodniu ciąży; matka została narażona na wirusa ospy wietrznej-półpaśca w 11 tygodniu ciąży, otrzymała immunoglobulinę ospy wietrznej-półpaśca 4 dni później, a następnie nabawiła się łagodnego ospy wietrznej z uszkodzeniami, bólem głowy i złym samopoczuciem po 13 tygodniach. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży czesc 4

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży cd

Etapy ciąży 120 kobiet w ciąży zakażonych wirusem ospy wietrznej. Badaniami objęto 120 kobiet z ospą wietrzną, z których 106 (88%) miało ospę wietrzną podczas pierwszych 20 tygodni ciąży (tab. 1) (81 kobiet było badanych w Toronto, 25 w Filadelfii, 12 w Camden i 2 w Salt Lake City). Chociaż cztery formularze wykorzystywały różne formy, wszystkie dane zebrano prospektywnie. Rozpoznanie ospy wietrznej i półpaśca zostało potwierdzone przez klinicystę u wszystkich pacjentów. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży cd

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Zebrano dane dotyczące wszystkich przypadków związanych z narażeniem podczas ciąży. W okresie od 8 do 12 miesięcy po przewidywanej dacie porodu przeszkolony ankieter z każdego ośrodka skontaktował się z każdą kobietą przez telefon i ukończył standardowy formularz kontrolny, w którym zapytano o wynik ciąży, masę urodzeniową oraz powikłania okołoporodowe i noworodkowe. Badacze z jednego ośrodka (Motherisk Program, Toronto) potwierdzili szczegóły podane w formularzu, prosząc o pisemną dokumentację od lekarza dziecka lub ze szpitala, jeśli dziecko zostało przyjęte do opieki. Badacze z trzech innych ośrodków (Pregnancy Healthline, Filadelfia, Riskline ciąży, Salt Lake City oraz Ciąża informacji o zagrożeniach ciąży, Camden, NJ) zapisali dane w sposób podobny do pierwszego ośrodka; uzyskali również szczegóły dotyczące obserwacji po porodzie, wykonując połączenia telefoniczne (Filadelfia, Salt Lake City i Camden) lub wysyłając kolejne karty (Filadelfia). Każdy pacjent był dopasowany do wieku (w ciągu jednego roku) z kobietą, która nie była narażona na ospę wietrzną, która uczestniczyła w programie Motherisk w tym samym dniu, co pacjent, który otrzymał poradę dotyczącą ekspozycji na czynnik nieterogenny (np. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad