Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Zespół Holt-Orama (Dziedziczenie Mendla w Człowieku numer 142900), zwany także zespołem serca i ręki, jest dziedzicznym zaburzeniem, które powoduje anomalie kończyn górnych i serca. Zespół ten jest przenoszony jako autosomalna dominująca cecha, która jest wysoce penetrantem, chociaż objawy kliniczne są różne i wahają się od subklinicznych objawów radiologicznych do jawnej, zagrażającej życiu choroby. Anomalie górnych kończyn są zawsze obecne. Mogą one być jednostronne lub obustronne i obejmować struktury pochodzące z embrionalnego promienia promieniowego, zazwyczaj kości promieniowej, nadgarstka i późnej. Aplasia, niedorozwój, fuzja i anomalny rozwój tych struktur dają szerokie spektrum fenotypów, w tym potrójne lub nieobecne kciuki, skrócone ramiona i phocomelia. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 7

W naszym badaniu jeden przypadek nadkomorowego obturacyjnego wodogłowia mógł być spowodowany zakażeniem ospą wietrzną-półpaścem; nie można jednak wyciągnąć ostatecznych wniosków, ponieważ dalsze dane serologiczne nie były dostępne. Zakażenie noworodkiem należy rozważyć, jeśli matka kurczy ospę wietrzną w ciągu ostatnich trzech tygodni ciąży. Nasilenie infekcji u noworodka związane jest z czasem wystąpienia infekcji u matki w czasie ciąży. Choroba może być łagodna, z kilkoma zmianami skórnymi (jak u pacjentów w naszym badaniu, którzy nabawili się ospy wietrznej 6 i 10 dni przed porodem) lub może być ciężka, z gorączką, wysypką krwotoczną i uogólnionym zaangażowaniem trzewnym. Ciężka choroba wiąże się ze śmiertelnością około 30 procent, ze śmiercią z powodu ciężkiej choroby płuc; jednak ponieważ dane te są stosunkowo stare, mogą nie odzwierciedlać postępów w krytycznej opiece nad chorymi noworodkami. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 7

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 6

Podczas badania kontrolnego po roku niemowlę to nie miało ani ospy wietrznej, ani półpaśca. Dyskusja
Badania epidemiologiczne teratogenności u ludzi zwykle obejmowały kobiety w ciąży narażone na leki, chemikalia lub czynniki zakaźne w pierwszym trymestrze lub, dokładniej, w okresie organogenezy. Jednakże, niekorzystne wyniki opisane w opisach przypadków4 sugerują, że okres ryzyka dla płodu spowodowany zakażeniem matczynym wirusem ospy wietrznej-półpaśca wykracza poza to okno, tak że niemowlęta urodzone z powodu embriopatii ospy wietrznej ulegają zakażeniu podczas pierwszych 20 tygodni ciąży. Obserwowaliśmy 106 kobiet zakażonych w tym okresie i oszacowaliśmy częstość występowania embriopatii ospy wietrznej na 1,2% (przedział ufności 95%, od 0 do 2,4%). To niskie ryzyko embriopatii sugeruje, że z nieznanych przyczyn zdolność wirusa do przechodzenia przez łożysko i zakażenia płodu jest ograniczona. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 6

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Tylko u dwóch pacjentów stwierdzono obecność alfa-fetoproteiny w surowicy po rozpoznaniu ospy wietrznej: matki niemowlęcia z zespołem ospy wietrznej opisanej powyżej oraz matki biorącej udział w badaniu klinicznym, w którym pomiar stężenia alfa-fetoproteiny był rutynową procedurą. W żadnym przypadku nie przeprowadzono reakcji łańcuchowej ani reakcji łańcuchowej polimerazy, aby zmierzyć przeciwciało płodu lub zidentyfikować wirusa w tkance płodu. Charakterystyka okołoporodowa
Obserwowano tendencję do przedwczesnych porodów (. 37 tygodni) u pacjentów, którzy zachorowali na ospę wietrzną w ciągu pierwszych 20 tygodni niż w grupie kontrolnej (14,3% [przedział ufności 95%, 10,5 do 18,1%] w porównaniu z 5,6% [zaufanie 95%] interwał, 3,2 do 8 procent], P = 0,05). Nie stwierdzono istotnej różnicy między niemowlętami z zakażeniem ospą wietrzną a grupą kontrolną w masie urodzeniowej (3336 . Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży czesc 4

W grupie z ospą wietrzną wystąpił nieistotny trend, w którym częściej zgłaszano planowe zakończenie leczenia (14,2% [przedział ufności 95%, 11 do 18%], w porównaniu z 7,5% [przedział ufności 95%, 4,9 do 10%] w grupie kontrolnej; P = 0,1) (tabela 3). Wszystkie spontaniczne poronienia w grupie ospy wietrznej wystąpiły w ciągu pierwszych 15 tygodni ciąży (dwa przypadki po 8 tygodniach, jeden o 9 tygodniach, jeden o 10 tygodniach i dwa o 12 tygodniach). Wszystkie zabiegi elektywne przeprowadzono przed 17 tygodniem ciąży, z różnych powodów (trzy zabiegi przeprowadzono z powodu postrzeganego ryzyka nieprawidłowości z powodu ospy wietrznej, jedna z powodu prenatalnej diagnozy choroby sierpowatokomórkowej, jedna z powodu ciąży wynikającej z gwałtu, i trzy z powodów osobistych lub społecznych, informacje na temat siedmiu procedur nie były dostępne). Spośród 86 żywych noworodków urodzonych w grupie ospy wietrznej, noworodek miał cechy odpowiadające embriopatii ospy wietrznej, z częstością 1,2% (przedział ufności 95%, od 0 do 2,4%). To niemowlę ważyło 1125 gi zostało dostarczone przez cesarskie cięcie w 35 tygodniu ciąży; matka została narażona na wirusa ospy wietrznej-półpaśca w 11 tygodniu ciąży, otrzymała immunoglobulinę ospy wietrznej-półpaśca 4 dni później, a następnie nabawiła się łagodnego ospy wietrznej z uszkodzeniami, bólem głowy i złym samopoczuciem po 13 tygodniach. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży czesc 4

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży cd

Etapy ciąży 120 kobiet w ciąży zakażonych wirusem ospy wietrznej. Badaniami objęto 120 kobiet z ospą wietrzną, z których 106 (88%) miało ospę wietrzną podczas pierwszych 20 tygodni ciąży (tab. 1) (81 kobiet było badanych w Toronto, 25 w Filadelfii, 12 w Camden i 2 w Salt Lake City). Chociaż cztery formularze wykorzystywały różne formy, wszystkie dane zebrano prospektywnie. Rozpoznanie ospy wietrznej i półpaśca zostało potwierdzone przez klinicystę u wszystkich pacjentów. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży cd

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Zebrano dane dotyczące wszystkich przypadków związanych z narażeniem podczas ciąży. W okresie od 8 do 12 miesięcy po przewidywanej dacie porodu przeszkolony ankieter z każdego ośrodka skontaktował się z każdą kobietą przez telefon i ukończył standardowy formularz kontrolny, w którym zapytano o wynik ciąży, masę urodzeniową oraz powikłania okołoporodowe i noworodkowe. Badacze z jednego ośrodka (Motherisk Program, Toronto) potwierdzili szczegóły podane w formularzu, prosząc o pisemną dokumentację od lekarza dziecka lub ze szpitala, jeśli dziecko zostało przyjęte do opieki. Badacze z trzech innych ośrodków (Pregnancy Healthline, Filadelfia, Riskline ciąży, Salt Lake City oraz Ciąża informacji o zagrożeniach ciąży, Camden, NJ) zapisali dane w sposób podobny do pierwszego ośrodka; uzyskali również szczegóły dotyczące obserwacji po porodzie, wykonując połączenia telefoniczne (Filadelfia, Salt Lake City i Camden) lub wysyłając kolejne karty (Filadelfia). Każdy pacjent był dopasowany do wieku (w ciągu jednego roku) z kobietą, która nie była narażona na ospę wietrzną, która uczestniczyła w programie Motherisk w tym samym dniu, co pacjent, który otrzymał poradę dotyczącą ekspozycji na czynnik nieterogenny (np. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 9

Niemniej należy odnotować kilka ograniczeń. Po pierwsze, złożoność logistyczna procesu wymagała projektu otwartej etykiety, wprowadzającego potencjalne uprzedzenia. Jednak zgodność z procedurą protokołu i lekami badanymi była wysoka, a wskaźnik tymczasowego stosowania inhibitorów glikoproteiny IIb / IIIa w grupie biwalirudyny był niski i podobny do tego w próbie REPLACE-2 z podwójnie ślepą próbą.20 Względne redukcje w powikłaniach krwotocznych z biwalirudyną w porównaniu z heparyną i inhibitorami glikoproteiny IIb / IIIa w niniejszym badaniu były również podobne do tych w badaniu REPLACE-2.20 Potencjalne stronniczość została dodatkowo złagodzona przez zastosowanie ślepych laboratoriów rdzeniowych i orzeczenie o zdarzeniu klinicznym komitet, który wymagał oryginalnej dokumentacji źródłowej do weryfikacji zdarzeń. Po drugie, bolus heparyny podawano w izbie przyjęć około 2/3 pacjentów, a biwalirudynę najczęściej rozpoczynano w laboratorium do cewnikowania serca 30 minut później, przed PCI. Testy interakcji wykazały jednak, że podawanie biwalirudyny znacząco zmniejszyło poważne krwawienie niezależnie od preproceduralnego podawania heparyny, a wstępne podawanie heparyny przed biwalirudyną wiązało się ze słabym trendem w kierunku zmniejszenia poważnych niekorzystnych zdarzeń sercowo-naczyniowych po 30 dniach. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 9

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 8

40% względne zmniejszenie dużego krwawienia w grupie biwalirudyny w porównaniu z grupą, która otrzymała heparynę z inhibitorem glikoproteiny IIb / IIIa, z podobnymi odsetkami powikłań niedokrwiennych, może zatem wyjaśnić obserwowaną poprawę przeżycia z biwalirudyną u pacjentów ze ST. zawał mięśnia sercowego z uniesieniem odcinka, który jest obarczony większym ryzykiem niż pacjenci w badaniu REPLACE-2. Ponadto antykoagulacja za pomocą biwalirudyny zmniejszyła występowanie ciężkiej trombocytopenii, która jest również silnie związana ze zgonem u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST oraz z PCI.14,15. Wśród pacjentów, u których udało się wszczepić stent, przypisanie do biwalirudyny w porównaniu z heparyną i inhibitorami glikoproteiny IIb / IIIa spowodowało 17 kolejnych epizodów zakrzepicy w stencie w ciągu pierwszych 24 godzin, co stanowi znaczny wzrost bezwzględny o 1,0%, co było częściowo przesunięte o 7 mniej zdarzeń u pacjentów leczonych biwalirudyną w okresie od 24 godzin do 30 dni (zmniejszenie bezwzględne, 0,5%). Wczesny wzrost zakrzepicy w stencie za pomocą samej biwalirudyny można wyjaśnić indukowaną dwufosforanem adenozynowym aktywację płytek krwi przed maksymalną blokadą tienopirydyny receptora P2Y1228 lub resztkową aktywnością trombiny po odstawieniu biwalirudyny. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 8