Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Zespół Holt-Orama (Dziedziczenie Mendla w Człowieku numer 142900), zwany także zespołem serca i ręki, jest dziedzicznym zaburzeniem, które powoduje anomalie kończyn górnych i serca. Zespół ten jest przenoszony jako autosomalna dominująca cecha, która jest wysoce penetrantem, chociaż objawy kliniczne są różne i wahają się od subklinicznych objawów radiologicznych do jawnej, zagrażającej życiu choroby. Anomalie górnych kończyn są zawsze obecne. Mogą one być jednostronne lub obustronne i obejmować struktury pochodzące z embrionalnego promienia promieniowego, zazwyczaj kości promieniowej, nadgarstka i późnej. Aplasia, niedorozwój, fuzja i anomalny rozwój tych struktur dają szerokie spektrum fenotypów, w tym potrójne lub nieobecne kciuki, skrócone ramiona i phocomelia. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Galazki wargowe

Gałązki wargowe są ważne głównie z tego względu, że kończąc się dookoła punktów osadzenia włosów zatokowych są nader ważnymi przenośnikami podniet dotykowych. W czasie swej wędrówki poprzez przewód podoczodołowy, n. podoczodołowy oddaje liczne –gałązki zębodołowe (rami a lreolares), tworzące w obrębie szczęki – splot zębowy górny(plexus dentalie sup. ). Od tego mianowicie splotu odrywają się drobne : gałązki dziąsłowe(11. Czytaj dalej Galazki wargowe

Nerw zwaczowy

Znaczenie tego związku będzie wyjaśnione dalej. N. żuchwowy opuszcza jamę czaszkową poprzez otwór poszarpany przedni, albo też przez otwór owalny, po czym dzieli się na szereg gałęzi wtórnych. Tymi gałęziami są: 1. – N. Czytaj dalej Nerw zwaczowy