Kolektywna dynamika palenia w dużej sieci społecznej ad 5

Słupki błędów w obu panelach pokazują 95% przedziały ufności na podstawie 1000 symulacji. Aby przeliczyć mile na kilometry, pomnożyć przez 1,6. Oba panele wykluczają sąsiada i więzy współpracowników. Rysunek 2A bardziej formalnie opisuje klastry w obrębie całej sieci, a na rycinie 2B scharakteryzowano wpływ odległości geograficznej między podmiotami i kontaktami (patrz poniżej). We wszystkich badaniach przeciętne ryzyko palenia wśród osób kontaktowych, które były powiązane z osobą palącą (w pewnym stopniu separacji) było o 61% wyższe w obserwowanej sieci niż w losowej sieci. Czytaj dalej Kolektywna dynamika palenia w dużej sieci społecznej ad 5

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Zespół Holt-Orama (Dziedziczenie Mendla w Człowieku numer 142900), zwany także zespołem serca i ręki, jest dziedzicznym zaburzeniem, które powoduje anomalie kończyn górnych i serca. Zespół ten jest przenoszony jako autosomalna dominująca cecha, która jest wysoce penetrantem, chociaż objawy kliniczne są różne i wahają się od subklinicznych objawów radiologicznych do jawnej, zagrażającej życiu choroby. Anomalie górnych kończyn są zawsze obecne. Mogą one być jednostronne lub obustronne i obejmować struktury pochodzące z embrionalnego promienia promieniowego, zazwyczaj kości promieniowej, nadgarstka i późnej. Aplasia, niedorozwój, fuzja i anomalny rozwój tych struktur dają szerokie spektrum fenotypów, w tym potrójne lub nieobecne kciuki, skrócone ramiona i phocomelia. Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand)

Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad 8

Rzeczywiście, wśród pacjentów w naszym badaniu, którzy zostali sklasyfikowani jako osoby wysokiego ryzyka (osoby starsze niż 70 lat i ci z przednim zawałem mięśnia sercowego, klasa Killip> I lub prezentująca częstość akcji serca> 100 uderzeń na minutę), 67% wszystkich pacjentów w badaniu wykazało słabą tendencję do większej korzyści leczenia skojarzonego, w porównaniu z leczeniem pierwotną PCI, z abciximabem podawanym w laboratorium cewnikowania bezpośrednio przed PCI (współczynnik ryzyka dla złożonego punktu końcowego, 0,84; 95% CI, 0,60 do 1,17), podczas gdy nie było korzyści dla pacjentów z niskim ryzykiem (współczynnik ryzyka, 1,22, 95% CI, 0,56 do 2,63). Te analizy podgrup nie powinny być jednak wykorzystywane do uzasadnienia stosowania PCI u pacjentów z grupy podwyższonego ryzyka ze względu na brak skojarzenia, z uwagi na brak wpływu na śmiertelność i nadmierne krwawienie obserwowane w tym badaniu. Po czwarte, odsetek dużych powikłań i zgonów wśród pacjentów z zawałem serca z uniesieniem odcinka ST, którzy przechodzą pierwotną PCI z towarzyszącym abciksymabem, jest dość niski, a zatem trudny do poprawy. Jednym z problemów podczas rozpoczynania badania było to, że terapia skojarzona może nie dać wystarczająco dużo czasu, aby była skuteczna, gdyby PCI podjęto szybko. Analiza podgrup, która oceniała czas od randomizacji do inflacji balonowej, nie uzasadnia tego problemu. Czytaj dalej Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad 8

Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST cd

W ośrodkach, które uczestniczyły w substytucji heparynowej o niskiej masie cząsteczkowej, dożylnie podawano 0,5 mg enoksaparyny na kilogram, a 0,3 mg na kilogram podawano podskórnie, bez docelowego czasu aktywacji krzepnięcia. Wszyscy pacjenci otrzymali od 81 do 325 mg aspiryny doustnie lub 250 do 500 mg dożylnie. Nie rozpoczęto infuzji abciximabu lub heparyny, chyba że PCI miało być opóźnione o maksymalnie 2 godziny. Przeniesienie pacjenta do laboratorium cewnikowania serca zostało przyspieszone, a procedury przeprowadzono zgodnie z lokalnymi standardami. Bezpośrednio przed PCI pacjenci z grupy placebo (pierwotnej PCI) otrzymywali zaślepione leczenie abciximabem (bolus 0,25 mg na kilogram podawany dożylnie). Czytaj dalej Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST cd

Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad

Stwierdzono, że sama terapia fibrynolityczna jest szkodliwa dla pacjentów pod względem oceny bezpieczeństwa i skuteczności nowej strategii leczenia za pomocą przezskórnej interwencji wieńcowej (ASSENT-4 PCI) (numer ClinicalTrials.gov, NCT00168792), 24 prawdopodobnie ze względu na szkodliwe działanie wczesnej aktywacji płytek krwi przez czynniki fibrynolityczne bez skutecznego leczenia przeciwpłytkowego lub krwotoku z łysiny w czasie PCI. Same inhibitory glikoproteiny IIb / IIIa, a zwłaszcza w połączeniu z terapią fibrynolityczną, oceniano u stosunkowo niewielkiej liczby pacjentów. Wyniki tych badań były niejednoznaczne, 25-30, chociaż istnieją dowody na wzrost poważnego krwawienia, szczególnie wśród osób starszych.31 Ułatwiona interwencja z rozszerzonym badaniem prędkości do zatrzymania zdarzeń (FINESSE) miała na celu sprawdzenie hipotezy, że PCI, która jest ułatwiona przy użyciu połączenia abcyksymabu i reteplazy o zmniejszonej dawce, byłaby bardziej skuteczna niż pierwotna PCI, w której abciximab jest podawany w laboratorium cewnikowania bezpośrednio przed PCI. Grupę, do której PCI ułatwiał sam abciximab, włączono w celu wyjaśnienia wpływu tego składnika terapii skojarzonej na wynik kliniczny.
Metody
Uczestnicy
Do badania zakwalifikowano pacjentów, którzy wystąpili w ciągu 6 godzin po wystąpieniu objawów przedmiotowych i podmiotowych niedokrwienia mięśnia sercowego, u których wystąpiło uniesienie odcinka ST sugerujące ostry zawał mięśnia sercowego, którzy kwalifikowali się do leczenia fibrynolitycznego lub pierwotnej PCI, oraz u których przewidywany czas do diagnostyki cewnikowanie trwało od do 4 godzin po randomizacji. Czytaj dalej Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad