Wyniki PCI w szpitalach z lub bez kardiochirurgii na miejscu AD 6

Ogólnie rzecz biorąc, pacjenci w rejestrze mieli mniej czynników ryzyka i mniej ciężką chorobę wieńcową niż losowo przydzielani uczestnicy badania (Tabela S2 w Dodatku Uzupełniającym). Spośród pacjentów poddanych randomizacji 319 nie poddano indeksowi PCI. Odsetek pacjentów, którzy nie podlegali wskaźnikowi PCI, był wyższy wśród uczestników przydzielonych do szpitali z operacją kardiochirurgiczną na miejscu niż wśród pacjentów przydzielonych do szpitali bez chirurgii na miejscu. Przyczyny obejmowały skierowanie na leczenie chirurgiczne lub medyczne oraz ustalenie zmiany patologicznej (Tabela S3 w Dodatku Uzupełniającym). Czytaj dalej Wyniki PCI w szpitalach z lub bez kardiochirurgii na miejscu AD 6

Analiza w skali ogólnoustrojowej i CXCL4 jako biomarker w leczeniu stwardnienia rozsianego AD 6

W analizie rozpoznawczej odkryliśmy, że poziomy CXCL4 stopniowo i znacząco zwiększały się w każdej grupie w następującej kolejności: pacjenci z pierwotnym objawem Raynauda, z objawem Raynauda i dodatnimi przeciwciałami przeciwjądrowymi oraz z bardzo wczesnym twardziną układową (zjawisko Raynauda plus anty-topoizomeraza lub przeciwciała przeciw centromerom i obecność angiopatii paznokciowej), podczas gdy poziomy CCL2, CXCL10, CCL5, czynnika von Willebranda i CCL18 nie wzrosły (fig. S2C w dodatkowym dodatku). Następnie oceniliśmy związek między poziomami CXCL4 a fenotypem klinicznym. Poziomy CXCL4 korelowały ze stopniem zwłóknienia skóry w ograniczonym fenotypie skórnym (R2 = 0,59, P <0,001) i dyfuzyjnym fenotypem skóry (R2 = 0,74, P <0,001). Czytaj dalej Analiza w skali ogólnoustrojowej i CXCL4 jako biomarker w leczeniu stwardnienia rozsianego AD 6

Fluktuacje masy ciała i wyniki w chorobie wieńcowej ad 7

Stwierdziliśmy również, że wysoka i niska zmienność masy ciała jest związana z większym bezwzględnym wzrostem ryzyka jakiegokolwiek zdarzenia wieńcowego u osób z nadwagą i otyłością niż u osób o prawidłowej masie ciała. Wreszcie, nasze dane wskazują, że zmienność masy ciała była silnie i niezależnie związana z nowo narodzoną cukrzycą. Związki zaobserwowane w naszym badaniu mogą być spowodowane przyczynami innymi niż przyczynowość. Wyższa zmienność masy ciała może być wskaźnikiem poważnych wcześniej istniejących chorób, które mają gorsze rokowanie. Jednak w naszym badaniu wykorzystano dane z randomizowanego badania, które wykluczało pacjentów ze złym rokowaniem. Czytaj dalej Fluktuacje masy ciała i wyniki w chorobie wieńcowej ad 7

10-letnie wyniki po monitorowaniu, chirurgii lub radioterapii w przypadku miejscowego raka prostaty ad 5

Kaplan-Meier Szacunkowe skumulowane prawdopodobieństwo poddania się radykalnej interwencji w okresie obserwacji, zgodnie z grupą leczenia.Radycyjna interwencja została zdefiniowana jako radykalna prostatektomia, radioterapia per-protokołem, radioterapia nieprotokowa (w tym brachyterapia) lub intensywna terapia ultradźwiękowa. Figura 2 pokazuje łączne prawdopodobieństwo otrzymania leczenia radykalnego. Pod koniec naszej zgłoszonej obserwacji ponad 85% mężczyzn przydzielonych do radioterapii lub chirurgii otrzymało radykalną interwencję. Spośród 545 mężczyzn przydzielonych do aktywnego monitoringu, 291 zostało poddanych radykalnej terapii do końca listopada 2015 r. (Szacunki Kaplana-Meiera, 54,8%, przedział ufności 95% [CI], 50,4 do 59,3). Czytaj dalej 10-letnie wyniki po monitorowaniu, chirurgii lub radioterapii w przypadku miejscowego raka prostaty ad 5

Kolektywna dynamika palenia w dużej sieci społecznej czesc 4

Wybrano losową próbkę 1000 osobników w sieci społecznościowej z Framingham Heart Study wybranego z największego połączonego podskładnika na egzaminie (po lewej) i badaniu 7 (po prawej). Każdy okrąg (węzeł) reprezentuje jedną osobę. Kręgi z czerwonymi obwódkami oznaczają kobiety, a koła z niebieskimi brzegami oznaczają mężczyzn. Wewnętrzny kolor kółka wskazuje na konsumpcję papierosa (żółty oznacza .1 papierosa dziennie, a zielony oznacza brak papierosów). Rozmiar każdego okręgu jest proporcjonalny do liczby zużytych papierosów. Czytaj dalej Kolektywna dynamika palenia w dużej sieci społecznej czesc 4

Wpływ terapii genowej na funkcję wzrokową w wrodzonej amaurozie Lebera ad 5

Nie zaobserwowaliśmy klinicznie znamiennej poprawy ostrości wzroku u żadnego z trzech pacjentów (Tabela 1) ani żadnej zmiany w obwodowych polach widzenia w badaniu perymetrycznym Goldmanna. Nie wykryliśmy żadnych zmian w odpowiedziach siatkówki na flash lub wzór elektroretinografii. Przed zabiegiem pacjent 2 miał oczopląs o wysokiej amplitudzie, który nie zmieniał się po leczeniu. Ryc. 2. Czytaj dalej Wpływ terapii genowej na funkcję wzrokową w wrodzonej amaurozie Lebera ad 5

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Tylko u dwóch pacjentów stwierdzono obecność alfa-fetoproteiny w surowicy po rozpoznaniu ospy wietrznej: matki niemowlęcia z zespołem ospy wietrznej opisanej powyżej oraz matki biorącej udział w badaniu klinicznym, w którym pomiar stężenia alfa-fetoproteiny był rutynową procedurą. W żadnym przypadku nie przeprowadzono reakcji łańcuchowej ani reakcji łańcuchowej polimerazy, aby zmierzyć przeciwciało płodu lub zidentyfikować wirusa w tkance płodu. Charakterystyka okołoporodowa
Obserwowano tendencję do przedwczesnych porodów (. 37 tygodni) u pacjentów, którzy zachorowali na ospę wietrzną w ciągu pierwszych 20 tygodni niż w grupie kontrolnej (14,3% [przedział ufności 95%, 10,5 do 18,1%] w porównaniu z 5,6% [zaufanie 95%] interwał, 3,2 do 8 procent], P = 0,05). Nie stwierdzono istotnej różnicy między niemowlętami z zakażeniem ospą wietrzną a grupą kontrolną w masie urodzeniowej (3336 . Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad 7

Nie doszło do krwotoków wewnątrzczaszkowych u pacjentów w wieku 75 lat i starszych. Ogólnie rzecz biorąc, odnotowano stopniowy wzrost częstości krwawienia, krwotoku wewnątrzczaszkowego i transfuzji w grupach z grupy PCI. We wszystkich trzech połączonych grupach leczenia śmiertelność była związana ze stopniem krwawienia (18,2% z dużym krwawieniem TIMI, 6,1% z niewielkim krwawieniem TIMI i 2,6% z niewielkim krwawieniem lub bez krwawienia; P <0,001). Dyskusja
Można oczekiwać, że terapia dla ostrego zawału mięśnia sercowego z uniesieniem odcinka ST, która mogłaby zainicjować reperfuzję przed PCI bez zwiększenia komplikacji, mogłaby przynieść korzyść kliniczną. Jednak do tej pory próby, które przetestowały koncepcję ułatwionej angioplastyki ze środkami fibrynolitycznymi i inhibitorami glikoproteiny IIb / IIIa, były ograniczone przez niewielką liczbę zarejestrowanych, ryzyko krwawienia wśród pacjentów otrzymujących terapię, rejestrację niskiego ryzyka. Czytaj dalej Ułatwiona PCI u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST ad 7