Podwyzszone cisnienie zwalnia czynnosc serca, niskie przyspiesza

Podwyższone ciśnienie zwalnia czynność serca, niskie przyśpiesza. To samo dotyczy odruchu z łuku aorty. Przepełnienie krwią naczyń- żylnych i tym samym zwiększenie się ciśnienia w żyłach i prawym przedsionku serca prowadzi do powstawania odruchu, polegającego n tym, i przez zwiększone ciśnienie tych odcinkach Układu krążenia następuje podrażnienie włókien czuciowych nerwu błędnego ,w prawym przedsionku. To pobudzenie, przenosząc się dośrodkowo, zmniejsza napięcie ośrodka nerwu błędnego,- co wywołuje przyśpieszenie bicia serca i wzmożony odpływ krwi. Odruch Goltza należy również do tej samej grupy odruchów wegetatywnych, -dochodzących do skutku z podrażnienia nerwu trzewnego. Czytaj dalej Podwyzszone cisnienie zwalnia czynnosc serca, niskie przyspiesza

Odruchy trzewno-skórne

Odruchy trzewno-skórne Poza odruchami wegetatywnymi trzewno-trzewnymi istnieją jeszcze odruchy trzewno-skórne. Odruchy trzewno-skórne zmieniają czynność wydzielniczą gruczołów potowych, wywołują skurcz mięśni gładkich skóry, co powoduje podnoszenie się włosów i zjawianie się tzw. gęsiej skórki. Przy tych odruchach spostrzega się także ograniczone przeczucie skóry. W różnych sprawach chorobowych narządów wewnętrznych stwierdzamy ograniczone zaburzenia czucia na skórze i zaburzenia w wydzielaniu potu. Czytaj dalej Odruchy trzewno-skórne

Galazki wargowe

Gałązki wargowe są ważne głównie z tego względu, że kończąc się dookoła punktów osadzenia włosów zatokowych są nader ważnymi przenośnikami podniet dotykowych. W czasie swej wędrówki poprzez przewód podoczodołowy, n. podoczodołowy oddaje liczne –gałązki zębodołowe (rami a lreolares), tworzące w obrębie szczęki – splot zębowy górny(plexus dentalie sup. ). Od tego mianowicie splotu odrywają się drobne : gałązki dziąsłowe(11. Czytaj dalej Galazki wargowe

Z jamy czaszkowej nerw wydostaje sie na zewnatrz przez otwór poszarpany tylny

Z jamy czaszkowej nerw wydostaje się na zewnątrz przez otwór poszarpany tylny, tworząc tutaj – zwój skalisty(gn. petrosum), Zwój ten jest, oczywiście, ośrodkiem macierzystym 1) części czuciowej n. IX, skąd dendryty podążają doobwodowo, neuryty zaś kierują się w stronę zamózgowia, aby się skończyć w dwóch- jądrach, położonych na dnie IV komory, a mianowicie w – jądrze czuciowym grzbietowym (nucleus seneibilie dorsaiis s. nucleus alae cinereae) i w – jądrze szlaku samotnego(nucleus tractus solitarii). Należy dodać, że obydwa te jądra są jednocześnie stacjami końcowymi i dla włókien czuciowych n. Czytaj dalej Z jamy czaszkowej nerw wydostaje sie na zewnatrz przez otwór poszarpany tylny

Różnicowanie odinfekcji przed nawrotem w nawracającej boreliozie AD 6

Tylko jeden pacjent (w odcinkach od 10 do 12) miał zakażenie tym samym genotypem ospC więcej niż raz (w niesekwencyjnych epizodach) (Tabela i Tabela 2). Chociaż nie można całkowicie wykluczyć nawrotu u tego pacjenta, wydaje się wątpliwe z wielu powodów. Dwa epizody rumienia wędrującego wywołane przez ten sam genotyp ospC były pojedynczymi zmianami skórnymi rumienia wędrującego zlokalizowanymi w różnych miejscach ciała (odpowiednio kostka i pośladek), a epizody te dzieliły 5 lat. Ponadto punkt punctum zaobserwowano w centrum zmiany w nawracającym epizodzie rumienia wędrującego. Czytaj dalej Różnicowanie odinfekcji przed nawrotem w nawracającej boreliozie AD 6

Skrócone leczenie przeciwbakteryjne w przypadku ostrego zapalenia ucha środkowego u małych dzieci ad 7

Po leczeniu przeciwdrobnoustrojowym w przypadku epizodu indeksu, poziom kolonizacji szczepami Streptococcus pneumoniae wrażliwymi na penicylinę zmniejszył się zarówno w grupie 10-dniowej, jak i 5-dniowej, a niewrażliwe szczepy stanowiły obecnie większy odsetek pozostałych izolatów pneumokoków. Z biegiem czasu kolonizacja zarówno wrażliwymi szczepami, jak i niewrażliwymi szczepami powróciła do poziomu, który był podobny do poziomu stwierdzonego przy wejściu do badania. Kolonizacja wrażliwymi szczepami i niewrażliwymi szczepami Haemophilus influenzae pozostała względnie niezmieniona. Odkrycia te znalazły również odzwierciedlenie zarówno w prostych, jak i warunkowych ilorazach szans – z których ostatni może służyć jako miara ogólnowspólnotowego wpływu leczenia przeciwdrobnoustrojowego na oporność13 – które nie różniło się znacząco między obiema grupami leczenia. Wśród dzieci, których izolaty nosowo-gardłowe odzyskano podczas epizodu indeksowego były albo patogeny niepatogenne, albo podatne na penicylinę i dla których przeprowadzono co najmniej jedną kolejną hodowlę, 85 z 181 dzieci (47%) w grupie 10-dniowej i 78 z 177 ( 44%) w grupie 5-dniowej ostatecznie okazało się być skolonizowane patogenem niewrażliwym na penicylinę (P = 0,58). Czytaj dalej Skrócone leczenie przeciwbakteryjne w przypadku ostrego zapalenia ucha środkowego u małych dzieci ad 7

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Zebrano dane dotyczące wszystkich przypadków związanych z narażeniem podczas ciąży. W okresie od 8 do 12 miesięcy po przewidywanej dacie porodu przeszkolony ankieter z każdego ośrodka skontaktował się z każdą kobietą przez telefon i ukończył standardowy formularz kontrolny, w którym zapytano o wynik ciąży, masę urodzeniową oraz powikłania okołoporodowe i noworodkowe. Badacze z jednego ośrodka (Motherisk Program, Toronto) potwierdzili szczegóły podane w formularzu, prosząc o pisemną dokumentację od lekarza dziecka lub ze szpitala, jeśli dziecko zostało przyjęte do opieki. Badacze z trzech innych ośrodków (Pregnancy Healthline, Filadelfia, Riskline ciąży, Salt Lake City oraz Ciąża informacji o zagrożeniach ciąży, Camden, NJ) zapisali dane w sposób podobny do pierwszego ośrodka; uzyskali również szczegóły dotyczące obserwacji po porodzie, wykonując połączenia telefoniczne (Filadelfia, Salt Lake City i Camden) lub wysyłając kolejne karty (Filadelfia). Każdy pacjent był dopasowany do wieku (w ciągu jednego roku) z kobietą, która nie była narażona na ospę wietrzną, która uczestniczyła w programie Motherisk w tym samym dniu, co pacjent, który otrzymał poradę dotyczącą ekspozycji na czynnik nieterogenny (np. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 5

Dwustronny poziom alfa wynoszący 0,05 został użyty do testowania wyższości. Zakładając prawdziwe 30-dniowe wskaźniki zdarzeń w przypadku poważnych krwawień i niepożądanych zdarzeń klinicznych, odpowiednio, 9% i 12% w grupie kontrolnej i odpowiednio 6% i 9% w grupie biwalirudynowej, z 1700 pacjentami w każdej grupie, próba miała 99% mocy, aby wykazać wyższość biwalirudyny w zmniejszaniu częstości występowania poważnego krwawienia i 80% mocy, aby wykazać wyższość w zakresie zmniejszania częstości występowania niepożądanych zdarzeń klinicznych. Wyniki kategoryczne porównano za pomocą testu chi-kwadrat lub dokładnego testu Fishera. Zmienne ciągłe zostały porównane za pomocą testu sumy rang Wilcoxona. Oprócz podstawowej analizy, która była oparta na proporcjach dwumianowych, wyniki time-to-event, określone za pomocą metod Kaplana-Meiera, zostały porównane za pomocą testu log-rank. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 5