Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Zebrano dane dotyczące wszystkich przypadków związanych z narażeniem podczas ciąży. W okresie od 8 do 12 miesięcy po przewidywanej dacie porodu przeszkolony ankieter z każdego ośrodka skontaktował się z każdą kobietą przez telefon i ukończył standardowy formularz kontrolny, w którym zapytano o wynik ciąży, masę urodzeniową oraz powikłania okołoporodowe i noworodkowe. Badacze z jednego ośrodka (Motherisk Program, Toronto) potwierdzili szczegóły podane w formularzu, prosząc o pisemną dokumentację od lekarza dziecka lub ze szpitala, jeśli dziecko zostało przyjęte do opieki. Badacze z trzech innych ośrodków (Pregnancy Healthline, Filadelfia, Riskline ciąży, Salt Lake City oraz Ciąża informacji o zagrożeniach ciąży, Camden, NJ) zapisali dane w sposób podobny do pierwszego ośrodka; uzyskali również szczegóły dotyczące obserwacji po porodzie, wykonując połączenia telefoniczne (Filadelfia, Salt Lake City i Camden) lub wysyłając kolejne karty (Filadelfia). Każdy pacjent był dopasowany do wieku (w ciągu jednego roku) z kobietą, która nie była narażona na ospę wietrzną, która uczestniczyła w programie Motherisk w tym samym dniu, co pacjent, który otrzymał poradę dotyczącą ekspozycji na czynnik nieterogenny (np. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Podwyzszone cisnienie zwalnia czynnosc serca, niskie przyspiesza

Podwyższone ciśnienie zwalnia czynność serca, niskie przyśpiesza. To samo dotyczy odruchu z łuku aorty. Przepełnienie krwią naczyń- żylnych i tym samym zwiększenie się ciśnienia w żyłach i prawym przedsionku serca prowadzi do powstawania odruchu, polegającego n tym, i przez zwiększone ciśnienie tych odcinkach Układu krążenia następuje podrażnienie włókien czuciowych nerwu błędnego ,w prawym przedsionku. To pobudzenie, przenosząc się dośrodkowo, zmniejsza napięcie ośrodka nerwu błędnego,- co wywołuje przyśpieszenie bicia serca i wzmożony odpływ krwi. Odruch Goltza należy również do tej samej grupy odruchów wegetatywnych, -dochodzących do skutku z podrażnienia nerwu trzewnego. Czytaj dalej Podwyzszone cisnienie zwalnia czynnosc serca, niskie przyspiesza

Odruchy trzewno-skórne

Odruchy trzewno-skórne Poza odruchami wegetatywnymi trzewno-trzewnymi istnieją jeszcze odruchy trzewno-skórne. Odruchy trzewno-skórne zmieniają czynność wydzielniczą gruczołów potowych, wywołują skurcz mięśni gładkich skóry, co powoduje podnoszenie się włosów i zjawianie się tzw. gęsiej skórki. Przy tych odruchach spostrzega się także ograniczone przeczucie skóry. W różnych sprawach chorobowych narządów wewnętrznych stwierdzamy ograniczone zaburzenia czucia na skórze i zaburzenia w wydzielaniu potu. Czytaj dalej Odruchy trzewno-skórne