Bezpieczeństwo i skuteczność przenoszenia genów na wrodzoną amaurozę Lebera cd

Obiektywne pomiary obejmowały ocenę źrenicowego odruchu świetlnego i badania oczopląsu. Subiektywne pomiary obejmowały standardowe testy ostrości wzroku, badanie pola wzrokowego Goldmanna i testowanie mobilności w celu oceny różnic w zdolnościach pacjentów do poruszania się po znormalizowanym torze przeszkód (Tabela i Rysunek 3 oraz sekcja Metody dodatku uzupełniającego i wideo). Ostrość wzroku została zmierzona przez przeszkolonych lekarzy wzroku przy użyciu standardowego protokołu obejmującego wykresy Retinopathy Studium Wczesnego Leczenia (ETDRS) i liczby liter. Wyniki liter zostały przekształcone w log minimalnego kąta rozdzielczości (logMAR), w skali od 0,00 do 2,00, z wyższymi wartościami wskazującymi gorsze widzenie. Oczom, które mogły wykryć ruchy rąk, przypisano wynik gorszy o jedną linię niż największa drukowana linia na wykresie testowanym w standardowej odległości 4 m (<20/1600), aby zapewnić najbardziej zachowawczą ocenę pod względem niedoszacowania rzeczywistego zakresu zaburzeń widzenia.17
Wyniki
Charakterystyka pacjentów
Trzej kolejni pacjenci, którzy mieli LCA2 i byli w wieku od 19 do 26 lat, wyrazili pisemną świadomą zgodę (patrz Dodatek dodatkowy). Czytaj dalej Bezpieczeństwo i skuteczność przenoszenia genów na wrodzoną amaurozę Lebera cd

Wpływ terapii genowej na funkcję wzrokową w wrodzonej amaurozie Lebera

Wczesny początek, ciężka dystrofia siatkówki spowodowana mutacjami w genie kodującym specyficzne dla nabłonka barwnikowego białko 65-kD (RPE65) wiąże się ze słabym wzrokiem przy urodzeniu i całkowitą utratą wzroku we wczesnej dorosłości. Podajemy trzem młodym dorosłym pacjentom podskórne iniekcje rekombinowanego wirusa adenowirusowego 2/2 eksprymującego RPE65 komplementarny DNA (cDNA) pod kontrolą ludzkiego promotora RPE65. Nie było poważnych zdarzeń niepożądanych. Nie stwierdzono klinicznie istotnych zmian ostrości wzroku lub obwodowych pól widzenia na obwodzie Goldmanna u żadnego z trzech pacjentów. Nie wykryliśmy żadnych zmian w odpowiedziach siatkówki na elektroretinografię. Czytaj dalej Wpływ terapii genowej na funkcję wzrokową w wrodzonej amaurozie Lebera

Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Zebrano dane dotyczące wszystkich przypadków związanych z narażeniem podczas ciąży. W okresie od 8 do 12 miesięcy po przewidywanej dacie porodu przeszkolony ankieter z każdego ośrodka skontaktował się z każdą kobietą przez telefon i ukończył standardowy formularz kontrolny, w którym zapytano o wynik ciąży, masę urodzeniową oraz powikłania okołoporodowe i noworodkowe. Badacze z jednego ośrodka (Motherisk Program, Toronto) potwierdzili szczegóły podane w formularzu, prosząc o pisemną dokumentację od lekarza dziecka lub ze szpitala, jeśli dziecko zostało przyjęte do opieki. Badacze z trzech innych ośrodków (Pregnancy Healthline, Filadelfia, Riskline ciąży, Salt Lake City oraz Ciąża informacji o zagrożeniach ciąży, Camden, NJ) zapisali dane w sposób podobny do pierwszego ośrodka; uzyskali również szczegóły dotyczące obserwacji po porodzie, wykonując połączenia telefoniczne (Filadelfia, Salt Lake City i Camden) lub wysyłając kolejne karty (Filadelfia). Każdy pacjent był dopasowany do wieku (w ciągu jednego roku) z kobietą, która nie była narażona na ospę wietrzną, która uczestniczyła w programie Motherisk w tym samym dniu, co pacjent, który otrzymał poradę dotyczącą ekspozycji na czynnik nieterogenny (np. Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 5

Dwustronny poziom alfa wynoszący 0,05 został użyty do testowania wyższości. Zakładając prawdziwe 30-dniowe wskaźniki zdarzeń w przypadku poważnych krwawień i niepożądanych zdarzeń klinicznych, odpowiednio, 9% i 12% w grupie kontrolnej i odpowiednio 6% i 9% w grupie biwalirudynowej, z 1700 pacjentami w każdej grupie, próba miała 99% mocy, aby wykazać wyższość biwalirudyny w zmniejszaniu częstości występowania poważnego krwawienia i 80% mocy, aby wykazać wyższość w zakresie zmniejszania częstości występowania niepożądanych zdarzeń klinicznych. Wyniki kategoryczne porównano za pomocą testu chi-kwadrat lub dokładnego testu Fishera. Zmienne ciągłe zostały porównane za pomocą testu sumy rang Wilcoxona. Oprócz podstawowej analizy, która była oparta na proporcjach dwumianowych, wyniki time-to-event, określone za pomocą metod Kaplana-Meiera, zostały porównane za pomocą testu log-rank. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad 5

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego cd

Randomizacja, strategia zarządzania i działania następcze po 30 dniach. Dwóch dodatkowych pacjentów, którzy nie wyrazili pisemnej zgody, zostało losowo przydzielonych do biwalirudyny, ale badanego leku nie podawano i nie zbierano danych dla tych pacjentów. Po arteriografii wieńcowej przeprowadzono drugą rundę randomizacji, z kwalifikowanymi pacjentami wyznaczonymi do przyjęcia stentu uwalniającego paklitaksel lub stentu z gołego metalu (nie pokazano). Wyniki tej randomizacji pozostają zaślepione. CABG oznacza pomostowanie aortalno-wieńcowe, glikoproteinę GP, przezskórną interwencję wieńcową PCI i zawał mięśnia sercowego z uniesieniem odcinka ST STI. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego cd

Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad

Dlatego przeprowadziliśmy badanie na dużą skalę, aby ocenić kliniczną wartość biwalirudyny u pacjentów z zawałem mięśnia sercowego z uniesieniem odcinka ST. Metody
Próba
Wyniki badań harmonizujących z rewaskularyzacją i stentami w ostrym zawale mięśnia sercowego (HORIZONS-AMI) były prospektywnymi, otwartymi, randomizowanymi, wieloośrodkowymi badaniami, w których porównywano biwalirudynę w monoterapii z heparyną i inhibitorem glikoproteiny IIb / IIIa u pacjentów ze zwiększeniem mięśnia sercowego z uniesieniem odcinka ST zawał, który przechodził pierwotną PCI. Badanie zostało zaprojektowane przez głównego badacza (dr. Stone a), komitet wykonawczy i komitet ds. Farmakologii. Czytaj dalej Biwalirudyna podczas pierwotnej PCI w ostrym zawale mięśnia sercowego ad

Napędzana ognistą śmiercią – tragedia samospalenia w Afganistanie ad

Chociaż formalne analizy i raporty nie zostały wygenerowane z tych recenzji, badacze zaangażowani w te raporty donoszą, że przymusowe i dziecięce małżeństwa, a także przemoc dokonywana przez mężów, teściów i inne żony mężów były powszechnymi prekursorami aktów samospalenia . Bardziej aktualne dane podkreślają wszechobecność praktyki: AIHRC i afgańskie Ministerstwo Spraw Kobiet zgłaszają identyfikację 106 przypadków samopodpalenia w 2006 roku; jeśli te wydarzenia są uważane za przykłady przemocy wobec kobiet, stanowią one od 5 do 6% wszystkich przypadków przemocy zgłoszonych w tym roku.2 W 2006 r. Medica Mondiale, niemiecka organizacja pozarządowa zajmująca się wspieraniem kobiet i dziewcząt w regionach zamieszanych w konflikty, przeprowadziła bardziej systematyczną analizę przypadków samospalenia, zbierając dane ze wszystkich centralnych szpitali – jedynych szpitali wyposażonych do obsługi poważnych przypadków oparzeń – w Kabulu, Wardak i Herat w Afganistanie. Przypadki samic płonących pacjentów z każdego szpitala zostały poddane przeglądowi, a akty pacjentów zostały zidentyfikowane jako samopodpalenie, jeśli oparzenia nie były zglobalizowane i występowały we wzorcu wskazującym na samozapylenie, zgodnie z ustaleniami członków personelu medycznego. Rodziny lub inne kontakty związane z ofiarami kobiet lub same ofiary, jeśli przeżyły, skontaktowano się w celu przeprowadzenia wywiadów w celu uzyskania informacji dotyczących rodziny kobiety i jej sytuacji życiowej. Czytaj dalej Napędzana ognistą śmiercią – tragedia samospalenia w Afganistanie ad