Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Polimorfizm CA amplifikowany przez startery DAO-2 jest również amplifikowany przez opublikowane startery dla anonimowego markera D12S1058.
Analizy sprzężeń
Przeprowadzono dwupunktowe analizy za pomocą MLINK (wersja 5.1), a analizy wielopunktowe wykonano za pomocą LINKMAP6,10, aby obliczyć wartości lod. Ocena lod wskazuje na statystyczne prawdopodobieństwo, że dwa loci genetyczne są połączone i jest obliczana ze stosunku prawdopodobieństwa odziedziczenia dwóch loci przy danej frakcji rekombinacyjnej . między loci a prawdopodobieństwem dziedziczenia obu loci, jeśli nie są one połączone w ludzkim loci. genom (theta = 0,5). Wartości Lod zmieniają się w zależności od frakcji rekombinacji, która jest zbliżona do genetycznej odległości między loci. Dwa loci to centymorgan (około milion par zasad DNA), jeśli rekombinują się w 1% wszystkich mejoz. Wynik punktowy wynoszący więcej niż 3 wskazuje na znaczące prawdopodobieństwo powiązania (szanse na połączenie, 1000: 1). Wynik N2 mniejszy niż -2 jest ogólnie akceptowany jako dowód przeciwko wiązaniu między loci. Penetrance of Holt-Oram syndrome został ustawiony na poziomie P na poziomie 0,95 dla wszystkich analiz. Częstości alleli zaczerpnięto z opublikowanych danych, gdy były dostępne i w inny sposób oszacowano niezależnie od co najmniej 30 chromosomów w badanej populacji.
Statystyczne analizy fenotypów
Wszyscy członkowie rodziny, którzy zostali przebadani klinicznie lub dla których dostępne były dane kliniczne, zostali uwzględnieni w analizach. Dane analizowano za pomocą testu chi-kwadrat.
Wyniki
Oceny kliniczne
Rysunek 1. Rycina 1. Dziedziczenie zespołu Holta-Orama w rodzinach A i B. Kwadraty oznaczają członków rodziny męskiej, kręgi członków rodziny płci żeńskiej, stałe symbole z zespołem Holta-Orama, wyraźne symbole niewrażliwych podmiotów, symbole z patykami, których status choroby jest niepewne i symbole z ukośnikiem nieżyjących członków rodziny.
Rodzina A (ryc. 1A) to krewniak z Ameryki Północnej, o którym doniesiono, że w 1966 r. Miał zespół Holta-Orama
[patrz też: dda cechy osobowości, usuwanie znamion poznan, szpital biziela urologia ]

Dodaj komentarz

Twój adres email nie zostanie opublikowany. Pola, których wypełnienie jest wymagane, są oznaczone symbolem *

Powiązane tematy z artykułem: dda cechy osobowości szpital biziela urologia usuwanie znamion poznan