Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Polimorficzne krótkie sekwencje powtórzeń tandemowych (również nazywane mikrosatelitami) zamplifikowano za pomocą reakcji łańcuchowej polimerazy (PCR) z użyciem opublikowanych sekwencji primerów nukleotydowych7,8 i analizowano na żelu denaturujących żelu poliakryloamidowo-mocznikowym jak opisano wcześniej6. W skrócie, 150 ng genomowego DNA amplifikowano w objętości 10 mikrolitrów zawierających 40 ng nieznakowanego startera oligonukleotydowego; 40 ng startera znakowanego końcowo fosforem-32; 200 mikroM każdy trifosforan deoksyadenozyny, trifosforan deoksycytydyny, trifosforan deoksyguanozyny i trifosforan deoksytymidyny; i 0,1 U polimerazy DNA AmpliTaq (Perkin-Elmer Cetus) z x buforem do PCR (10 mM TRIS, pH 8,3, 50 mM chlorek potasu, 1,5 mM chlorek magnezu i 0,01 procent żelatyny) (Perkin-Elmer Cetus). Próbki przetwarzano przez 30 cykli, w tym przez denaturację przez 20 sekund w 94 ° C, przyłączanie starterów przez 30 sekund w 55 ° C i wydłużanie startera przez 45 sekund w 72 ° C, a następnie kolejne 10 minut wydłużania w 72 ° C. Zamplifikowane produkty poddano elektroforezie na żelu do sekwencjonowania 6% poliakryloamidem i wizualizowano metodą autoradiografii. Dwa dimeryczne polimorfizmy w regionie o długości 500 par zasad genu oksydazy d-aminokwasu (DAO) 9 zostały zamplifikowane za pomocą następujących starterów: Starter DAO-1 do przodu: 5 CCTGCTCCACACTTACACAGAC3 , DAO-1 reverse primer: 5 GCAAGCTTGGAGTATGTATCCC3 Przedni primer DAO-2: 5 GATTTTACCTAAGGCTGGATCTG3 , i odwrotny primer DAO-2: 5 GACACTGATTATAGCAACGTGTGT3 . Czytaj dalej Kliniczne i genetyczne spektrum zespołu Holta-Orama (zespół Heart-Hand) ad

Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

Tylko u dwóch pacjentów stwierdzono obecność alfa-fetoproteiny w surowicy po rozpoznaniu ospy wietrznej: matki niemowlęcia z zespołem ospy wietrznej opisanej powyżej oraz matki biorącej udział w badaniu klinicznym, w którym pomiar stężenia alfa-fetoproteiny był rutynową procedurą. W żadnym przypadku nie przeprowadzono reakcji łańcuchowej ani reakcji łańcuchowej polimerazy, aby zmierzyć przeciwciało płodu lub zidentyfikować wirusa w tkance płodu. Charakterystyka okołoporodowa
Obserwowano tendencję do przedwczesnych porodów (. 37 tygodni) u pacjentów, którzy zachorowali na ospę wietrzną w ciągu pierwszych 20 tygodni niż w grupie kontrolnej (14,3% [przedział ufności 95%, 10,5 do 18,1%] w porównaniu z 5,6% [zaufanie 95%] interwał, 3,2 do 8 procent], P = 0,05). Nie stwierdzono istotnej różnicy między niemowlętami z zakażeniem ospą wietrzną a grupą kontrolną w masie urodzeniowej (3336 . Czytaj dalej Wynik po zakażeniu matczykową varicellą w pierwszych 20 tygodniach ciąży ad 5

ROLA UKLADU WEGETATYWNEGO, W ZJAWISKACH ODRUCHOWYCH

ROLA UKŁADU WEGĘTATYWNEGO, W ZJAWISKACH ODRUCHOWYCH Układ wegetatywny bierze również udział w rozmaitych zjawiskach, odruchowych. W wyniku bowiem podrażnień skóry lub narządów wewnętrznych rozmaitymi czynnikami powstają odruchy przy udziale nerwów wegetatywnych. Odruchy trzewno-trzewne Do odruchów wegetatywnych należy zaliczyć odruch oko – sercowy: (odruch Aschnera), cechujący się tym, że ucisk na gałkę oczną wywołuje zwolnienie czynności serca . U ludzi z normalnie zrównoważonym układem, wegetatywnym niebolesny ucisk na gałkę oczną, trwający około 30 sekund, zwalnia czynność serca o 4–12 uderzeń na l minutę. U ludzi z czynnościową przewagą nerwu błędnego zwolnienie czynności serca jest większe. Czytaj dalej ROLA UKLADU WEGETATYWNEGO, W ZJAWISKACH ODRUCHOWYCH

UDZIAL UKLADU WEGETATYWNEGO W OGÓLNYCH ODCZYNACH USTROJU

UDZIAŁ UKŁADU WEGETATYWNEGO W OGÓLNYCH ODCZYNACH USTROJU Układ wegetatywny nerwowy wspólnie z układem somatycznym bierze udział w ogólnych odczynach ustroju na działaniu czynników zewnętrznych. Wszelkie bowiem szybkie oddziaływanie ustroju na zmiany środowiska zewnętrznego dochodzi do skutku przy udziale wielu narządów. Oddziaływanie ustroju przejawia się przede wszystkim w czynności mięśni, której zawsze towarzyszy zmiana w krążeniu, oddychaniu, trawieniu, wydzielaniu i w przemianie materii. Wszystkie więc zmiany w czynności narządów są nieodzowne do przystosowania się ustroju i oddziaływania jego na wpływ zewnętrznego środowiska. W związku z tym podczas pracy mięśniowej występują przyśpieszenie czynności serca, przemieszczenie krwi przepływającej przez różne narządy, zwiększenie krwi krążącej z powodu wyrzucania jej ze zbiorników, wzmożenie oddychania, mobilizacja cukru ze składnio glikogenowych itd. Czytaj dalej UDZIAL UKLADU WEGETATYWNEGO W OGÓLNYCH ODCZYNACH USTROJU